http://compbio.mcs.anl.gov/blast/psiblast_phylo.cgi
http://compbio.mcs.anl.gov/blast/BloBla.html
Job title:
>ATCATTAAATACAGTAGATTTCTACTGATCGGGGGGGGTGGAAAGTCCCAGTTTGATTACTGGATCGCGAGTAAGCCCC
CTGTCTGCACCCTTGTCTTTTGCGTACTTATGTTTCCTCGGCGGGCTTGCCTGCCGAATGGACAATTCTAAAACCTTTT
TAATTTTCAATCAGCGTCTGAACAATTATAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAG
AACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCT
TGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTATGCTTGGTGTTGGGTGTTTGTCCTCTCC
CTTGCGTTTGGACTCGCCTTAAAGAAATTGGCAGCCAGTGTATTGGTATAGAAGCGCAGCACAATTTGCGACTCTAGCT
AATAATTACTTGCAACCATCAAGTCTA
STRAIN CBL001 / PHOMA.SP (PLEOSPORA) PSI BLAST ASSOCIATED STRAINS
-----------------------------------------------------------------------------------------------------------------------------------------------------------------------------
NCBI Protein banner
My NCBI
[Sign In] [Register]
PubMed Nucleotide Protein Genome Structure PMC Taxonomy OMIM Books
Search for
Limits Preview/Index History Clipboard Details
Display Show
Range: from to Features: SNP CDD MGC HPRD STS tRNA microRNA Exon
1: ZP_00680344. Reports conserved hypothe...[gi:71898158] BLink, Links
* Comment
* Features
* Sequence
LOCUS ZP_00680344 125 aa linear BCT 08-AUG-2005
DEFINITION conserved hypothetical protein [Xylella fastidiosa Ann-1].
ACCESSION ZP_00680344
VERSION ZP_00680344.1 GI:71898158
DBSOURCE REFSEQ: accession NZ_AAAM03000004.1
KEYWORDS .
SOURCE Xylella fastidiosa Ann-1
ORGANISM Xylella fastidiosa Ann-1
Bacteria; Proteobacteria; Gammaproteobacteria; Xanthomonadales;
Xanthomonadaceae; Xylella.
REFERENCE 1 (residues 1 to 125)
AUTHORS Copeland,A., Lucas,S., Lapidus,A., Barry,K., Detter,J.C.,
Glavina,T., Hammon,N., Israni,S., Pitluck,S. and Richardson,P.
CONSRTM US DOE Joint Genome Institute (JGI-PGF)
TITLE Sequencing of the draft genome and assembly of Xylella fastiodiosa
Ann-1
JOURNAL Unpublished
REFERENCE 2 (residues 1 to 125)
AUTHORS Larimer,F. and Land,M.
CONSRTM US DOE Joint Genome Institute (JGI_ORNL)
TITLE Annotation of the draft genome assembly of Xylella fastidiosa Ann-1
JOURNAL Unpublished
REFERENCE 3 (residues 1 to 125)
AUTHORS Copeland,A., Lucas,S., Lapidus,A., Barry,K., Detter,J.C.,
Glavina,T., Hammon,N., Israni,S., Pitluck,S. and Richardson,P.
CONSRTM US DOE Joint Genome Institute (JGI-PGF)
TITLE Direct Submission
JOURNAL Submitted (28-JUL-2005) US DOE Joint Genome Institute, 2800
Mitchell Drive, Walnut Creek, CA 94598, USA
REFERENCE 4 (residues 1 to 125)
AUTHORS DOE Joint Genome Institute.
TITLE Direct Submission
JOURNAL Submitted (08-JUL-2002) Production Genomics Facility, DOE Joint
Genome Institute, 2800 Mitchell Drive, Walnut Creek, CA 94598, USA
COMMENT PREDICTED REFSEQ: The mRNA record is supported by experimental
evidence; however, the coding sequence is predicted. The reference
sequence was derived from EAO34188.
URL -- http://www.jgi.doe.gov
Source DNA and bacteria available from Sandy Purcell
(purcell@nature.berkeley.edu)
Whole genome sequencing and draft assembly at JGI-PGF
Annotation by JGI-ORNL
Contact: Paul Richardson: (microbes@cuba.jgi-psf.org).
Method: conceptual translation.
FEATURES Location/Qualifiers
source 1..125
/organism="Xylella fastidiosa Ann-1"
/strain="Ann-1"
/db_xref="taxon:155920"
Protein 1..125
/product="conserved hypothetical protein"
/calculated_mol_wt=11121
sig_peptide 1..19
/note="Signal predicted by SignalP 2.0 HMM (Signal peptide
probabilty 1.000) with cleavage site probability 0.979 at
residue 19"
/calculated_mol_wt=1964
CDS 1..125
/locus_tag="XfasoDRAFT_3722"
/coded_by="complement(NZ_AAAM03000004.1:113777..114154)"
/inference="non-experimental evidence, no additional
details recorded"
/transl_table=11
ORIGIN
1 mkrivvccll lasisvsagt lykwkdangv shysgtppqr aqsfetisvs hhgesavssq
61 tasvespacv narknlells gsgklmldsn gdgkpdtpld eaqrvaqkal aeaaikanct
121 atpsh
//
Disclaimer | Write to the Help Desk
NCBI | NLM | NIH
Aug 28 2007 16:53:42
----------------------------------------------------------------------------------------------------------------
2/
NCBI Protein banner
My NCBI
[Sign In] [Register]
PubMed Nucleotide Protein Genome Structure PMC Taxonomy OMIM Books
Search for
Limits Preview/Index History Clipboard Details
Display Show
Range: from to Features: CDD SNP MGC HPRD STS tRNA microRNA Exon
1: ZP_00109969. Reports COG0569: K+ trans...[gi:23128113] BLink, Conserved Domains, Links
* Comment
* Features
* Sequence
LOCUS ZP_00109969 225 aa linear BCT 01-OCT-2004
DEFINITION COG0569: K+ transport systems, NAD-binding component
[Nostoc punctiforme PCC 73102].
ACCESSION ZP_00109969
VERSION ZP_00109969.1 GI:23128113
DBSOURCE REFSEQ: accession NZ_AAAY02000016.1
KEYWORDS .
SOURCE Nostoc punctiforme PCC 73102 (Nostoc punctiforme ATCC 29133)
ORGANISM Nostoc punctiforme PCC 73102
Bacteria; Cyanobacteria; Nostocales; Nostocaceae; Nostoc.
REFERENCE 1 (residues 1 to 225)
AUTHORS NCBI Microbial Genomes Annotation Project.
TITLE Direct Submission
JOURNAL Submitted (01-OCT-2004) National Center for Biotechnology
Information, NIH, Bethesda, MD 20894, USA
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from an annotated genomic sequence
(NZ_AAAY02000016) using gene prediction method: GeneMark.
Also see:
Documentation of NCBI's Annotation Process
Protein-coding genes were predicted using GeneMark and GeneMarkHMM
programs (kindly provided by M. Borodovsky). Functional annotation
is based on CDD (Conserved Domain Database) and COG (Clusters of
Orthologous Groups) assignments, it has not yet been subject to
manual review. DNA sequence and predicted proteins are available
for BLAST at http://www.ncbi.nlm.nih.gov/sutils/genom_table.cgi.
Method: conceptual translation.
FEATURES Location/Qualifiers
source 1..225
/organism="Nostoc punctiforme PCC 73102"
/strain="PCC 73102"
/db_xref="taxon:63737"
Protein 1..225
/product="COG0569: K+ transport systems, NAD-binding
component"
/calculated_mol_wt=24086
Region 1..222
/region_name="TrkA"
/note="K+ transport systems, NAD-binding component
[Inorganic ion transport and metabolism]; COG0569"
/db_xref="CDD:30915"
Region 3..117
/region_name="TrkA_N"
/note="TrkA-N domain. This domain is found in a wide
variety of proteins. These protein include potassium
channels, phosphoesterases, and various other
transporters. This domain binds to NAD; pfam02254"
/db_xref="CDD:85929"
Region 148..222
/region_name="TrkA_C"
/note="TrkA-C domain. This domain is often found next to
the pfam02254 domain. The exact function of this domain is
unknown. It has been suggested that it may bind an
unidentified ligand. The domain is predicted to adopt an
all beta structure; pfam02080"
/db_xref="CDD:85856"
CDS 1..225
/locus_tag="Npun02002479"
/coded_by="NZ_AAAY02000016.1:105081..105758"
/db_xref="CDD:pfam01262"
/db_xref="CDD:pfam02080"
/db_xref="CDD:pfam02254"
/db_xref="CDD:pfam03721"
/db_xref="COG:COG0569"
ORIGIN
1 myvliggagl vglslaqklv elghtvavid vdpiacryar eqvgamafeg savstevlle
61 agirkagsla avlrsdalnl amvtlakhyg vthilsrmrh pdfaeplria ganhiistve
121 lsvstmvnai eypqvesmmh feqgqievlk laipnncyva grsvaeiaqd arfpsgslii
181 gyqshphedl mipngstile phstvlivtk pgslhqvidf ieqrc
//
Disclaimer | Write to the Help Desk
NCBI | NLM | NIH
Aug 28 2007 16:53:42
----------------------------------------------------------------------------------------------------------------
3/
NCBI Protein banner
My NCBI
[Sign In] [Register]
PubMed Nucleotide Protein Genome Structure PMC Taxonomy OMIM Books
Search for
Limits Preview/Index History Clipboard Details
Display Show
Range: from to Features: SNP CDD MGC HPRD STS tRNA microRNA Exon
1: ZP_00050800. Reports hypothetical prot...[gi:23009933] BLink, Links
* Comment
* Features
* Sequence
LOCUS ZP_00050800 258 aa linear BCT 30-SEP-2004
DEFINITION hypothetical protein Magn03004757 [Magnetospirillum magnetotacticum
MS-1].
ACCESSION ZP_00050800
VERSION ZP_00050800.1 GI:23009933
DBSOURCE REFSEQ: accession NZ_AAAP01002765.1
KEYWORDS .
SOURCE Magnetospirillum magnetotacticum MS-1
ORGANISM Magnetospirillum magnetotacticum MS-1
Bacteria; Proteobacteria; Alphaproteobacteria; Rhodospirillales;
Rhodospirillaceae; Magnetospirillum.
REFERENCE 1 (residues 1 to 258)
AUTHORS NCBI Microbial Genomes Annotation Project.
TITLE Direct Submission
JOURNAL Submitted (30-SEP-2004) National Center for Biotechnology
Information, NIH, Bethesda, MD 20894, USA
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from an annotated genomic sequence
(NZ_AAAP01002765) using gene prediction method: GeneMark.
Also see:
Documentation of NCBI's Annotation Process
Protein-coding genes were predicted using GeneMark and GeneMarkHMM
programs (kindly provided by M. Borodovsky). Functional annotation
is based on CDD (Conserved Domain Database) and COG (Clusters of
Orthologous Groups) assignments, it has not yet been subject to
manual review. DNA sequence and predicted proteins are available
for BLAST at http://www.ncbi.nlm.nih.gov/sutils/genom_table.cgi.
COMPLETENESS: incomplete on the amino end.
Method: conceptual translation.
FEATURES Location/Qualifiers
source 1..258
/organism="Magnetospirillum magnetotacticum MS-1"
/strain="MS-1"
/db_xref="taxon:272627"
Protein <1..258 product="hypothetical protein" calculated_mol_wt="29202" locus_tag="Magn03004757" coded_by="NZ_AAAP01002765.1:<3..779" organism="Rhodobacter sphaeroides 2.4.1" strain="2.4.1; ATCC BAA-808" db_xref="ATCC:BAA-808" db_xref="taxon:272943" chromosome="1" product="ABC branched chain amino acid transporter, substrate binding protein" calculated_mol_wt="46250" region_name="LivK" note="ABC-type branched-chain amino acid transport systems, periplasmic component [Amino acid transport and metabolism]; COG0683" db_xref="CDD:31027" region_name="ANF_receptor" note="Receptor family ligand binding region. This family includes extracellular ligand binding domains of a wide range of receptors. This family also includes the bacterial amino acid binding proteins of known structure; pfam01094" db_xref="CDD:85237" locus_tag="RSP_0301" coded_by="complement(NC_007493.1:2031307..2032587)" inference="non-experimental evidence, no additional details recorded" note="COG0683: ABC-type branched-chain amino acid transport systems periplasmic component (LivK). Citation: Choudhary M, Kaplan S. Nucleic Acids Res. 2000 28(4):862-7." transl_table="11" db_xref="GeneID:3719156" organism="Ustilago maydis 521" strain="521" db_xref="taxon:237631" chromosome="17" product="hypothetical protein" calculated_mol_wt="74837" region_name="zf-C2H2" note="Zinc finger, C2H2 type. The C2H2 zinc finger is the classical zinc finger domain. The two conserved cysteines and histidines co-ordinate a zinc ion. The following pattern describes the zinc finger; pfam00096" db_xref="CDD:84515" region_name="zf-C2H2" note="Zinc finger, C2H2 type. The C2H2 zinc finger is the classical zinc finger domain. The two conserved cysteines and histidines co-ordinate a zinc ion. The following pattern describes the zinc finger; pfam00096" db_xref="CDD:84515" locus_tag="UM04774.1" coded_by="XM_755828.1:1..2163" db_xref="GeneID:3632886" organism="Giardia lamblia ATCC 50803" strain="WB C6" db_xref="ATCC:50803" db_xref="taxon:184922" product="hypothetical protein" calculated_mol_wt="160963" locus_tag="GLP_572_18947_14574" coded_by="XM_765070.1:1..4374" inference="non-experimental evidence, no additional details recorded" db_xref="GeneID:3526910" organism="Neurospora crassa OR74A" strain="OR74A" db_xref="taxon:367110" product="hypothetical protein" calculated_mol_wt="37454" locus_tag="NCU05912.1" coded_by="XM_953019.1:1..1035" db_xref="GeneID:3874259" organism="Pseudomonas aeruginosa PAO1" strain="PAO1" db_xref="taxon:208964" product="bifunctional UDP-glucuronic acid decarboxylase/UDP-4-amino-4-deoxy-L-arabinose formyltransferase" calculated_mol_wt="74230" region_name="PRK08125" note="bifunctional UDP-glucuronic acid decarboxylase/UDP-4-amino-4-deoxy-L-arabinose formyltransferase; PRK08125" db_xref="CDD:82486" region_name="Formyl_trans_N" note="Formyl transferase. This family includes the following members. Glycinamide ribonucleotide transformylase catalyses the third step in de novo purine biosynthesis, the transfer of a formyl group to 5'-phosphoribosylglycinamide; pfam00551" db_xref="CDD:84855" region_name="Formyl_trans_C" note="Formyl transferase, C-terminal domain; pfam02911" db_xref="CDD:86180" region_name="PRK11908" note="hypothetical protein; PRK11908" db_xref="CDD:84032" locus_tag="PA3554" coded_by="NC_002516.2:3982021..3984009" note="Bifunctional polymyxin resistance arnA protein; catalyzes the decarboxylation of UDP-glucuronic acid to UDP-4-keto-arabinose and the addition of a formyl group to UDP-4-amino-4-deoxy-L-arabinose to form UDP-L-4-formamido-arabinose; active in certain mutant" transl_table="11" db_xref="GeneID:878473" organism="Yersinia pestis KIM" strain="KIM" db_xref="taxon:187410" product="phosphoheptose isomerase" function="enzyme; surface polysaccharides and antigens" calculated_mol_wt="20798" region_name="gmhA" note="phosphoheptose isomerase; PRK00414" db_xref="CDD:80657" region_name="GmhA" note="Phosphoheptose isomerase [Carbohydrate transport and metabolism]; COG0279" db_xref="CDD:30627" gene="gmhA" locus_tag="y0947" coded_by="NC_004088.1:1069309..1069890" note="catalyzes the isomerization of sedoheptulose 7-phosphate to D-glycero-D-manno-heptose 7-phosphate" transl_table="11" db_xref="GeneID:1145894" organism="Neurospora crassa OR74A" strain="OR74A" db_xref="taxon:367110" chromosome="II" product="hypothetical protein" calculated_mol_wt="12332" locus_tag="NCU06794.1" coded_by="XM_958542.1:1..339" db_xref="GeneID:3879775" organism="Bacillus anthracis str. Ames" strain="Ames" db_xref="taxon:198094" product="prophage LambdaBa04, terminase, large subunit, putative" calculated_mol_wt="64599" region_name="COG4626" note="Phage terminase-like protein, large subunit [General function prediction only]; COG4626" db_xref="CDD:34246" locus_tag="BA0465" coded_by="NC_003997.3:464512..466200" note="identified by match to PFAM protein family HMM PF03354" transl_table="11" db_xref="GeneID:1084978" organism="Cytophaga hutchinsonii ATCC 33406" strain="ATCC 33406" db_xref="ATCC:33406" db_xref="taxon:269798" product="restriction endonuclease" calculated_mol_wt="33869" region_name="Mrr" note="Restriction endonuclease [Defense mechanisms]; COG1715" db_xref="CDD:31901" region_name="Mrr_cat" note="Restriction endonuclease. Prokaryotic family found in type II restriction enzymes containing the hallmark (D/E)-(D/E)XK active site. Presence of catalytic residues implicates this region in the enzymatic cleavage of DNA; pfam04471" db_xref="CDD:86670" gene="mrr" locus_tag="CHU_3348" coded_by="complement(NC_008255.1:3825218..3826117)" transl_table="11" db_xref="GeneID:4184598" iteration1 ="=" organism="Fusobacterium nucleatum subsp. vincentii ATCC 49256" strain="ATCC 49256" sub_species="vincentii" db_xref="taxon:209882" product="SHORT CHAIN DEHYDROGENASE" calculated_mol_wt="19698" region_name="fabG" note="3-ketoacyl-(acyl-carrier-protein) reductase; PRK12825" db_xref="CDD:84317" locus_tag="FNV1732" coded_by="NZ_AABF02000024.1:217..774" transl_table="11" organism="Gibberella zeae PH-1" strain="PH-1; NRRL 31084" db_xref="taxon:229533" chromosome="4" anamorph="Fusarium graminearum" product="hypothetical protein" calculated_mol_wt="95616" region_name="OPT" note="OPT oligopeptide transporter protein. The OPT family of oligopeptide transporters is distinct from the ABC pfam00005 and PTR pfam00854 transporter families; pfam03169" db_xref="CDD:66819" locus_tag="FG09287.1" coded_by="XM_389463.1:1..2556" db_xref="GeneID:2791434" organism="Pseudomonas aeruginosa 2192" strain="2192" db_xref="taxon:350703" product="COG0524: Sugar kinases, ribokinase family" calculated_mol_wt="31603" region_name="ribokinase" note="Ribokinase catalyses the phosphorylation of ribose to ribose-5-phosphate using ATP. This reaction is the first step in the ribose metabolism; cd01174" db_xref="CDD:29358" site_type="other" note="substrate binding site" db_xref="CDD:29358" site_type="other" note="dimer interface" db_xref="CDD:29358" site_type="other" note="ATP binding site" db_xref="CDD:29358" locus_tag="Paer2_01000999" coded_by="NZ_AAKW01000013.1:82130..83056" db_xref="COG:COG0524" pageid="10506376)." organism="Mycobacterium flavescens PYR-GCK" strain="PYR-GCK" db_xref="taxon:350054" product="Zinc-containing alcohol dehydrogenase superfamily" calculated_mol_wt="35760" region_name="Tdh" note="Threonine dehydrogenase and related Zn-dependent dehydrogenases [Amino acid transport and metabolism / General function prediction only]; COG1063" db_xref="CDD:31263" region_name="ADH_N" note="Alcohol dehydrogenase GroES-like domain. This is the catalytic domain of alcohol dehydrogenases. Many of them contain an inserted zinc binding domain. This domain has a GroES-like structure; pfam08240" db_xref="CDD:87467" region_name="ADH_zinc_N" note="Zinc-binding dehydrogenase; pfam00107" db_xref="CDD:84524" locus_tag="MflvDRAFT_2433" coded_by="complement(NZ_AAPA01000007.1:237838..238863)" transl_table="11" db_xref="InterPro:IPR002085" db_xref="InterPro:IPR002328" db_xref="InterPro:IPR011597" organism="Escherichia coli" db_xref="taxon:562" plasmid="pC15-1a" product="ECs1338" calculated_mol_wt="13029" region_name="Transposase_34" note="IS66 Orf2 like protein. This protein is found in insertion sequences related to IS66. The function of these proteins is uncertain, but they are probably essential for transposition; pfam05717" db_xref="CDD:69252" gene="ECs1338" locus_tag="pC15-1a_046" coded_by="NC_005327.1:45712..46062" transl_table="11" db_xref="GeneID:2716527" organism="Neurospora crassa OR74A" strain="OR74A" db_xref="taxon:367110" chromosome="I" product="hypothetical protein" calculated_mol_wt="16840" locus_tag="NCU00716.1" coded_by="XM_959457.1:1..465" db_xref="GeneID:3880701" organism="Mesorhizobium sp. BNC1" strain="BNC1" db_xref="taxon:266779" product="Curlin associated" calculated_mol_wt="12344" product="hypothetical protein" note="Signal predicted by SignalP 2.0 HMM (Signal peptide probabilty 1.000) with cleavage site probability 0.997 at residue 25" calculated_mol_wt="2622" region_name="PRK10101" note="curlin nucleator protein, minor subunit in curli complex; PRK10101" db_xref="CDD:77589" locus_tag="Meso_0924" coded_by="NC_008254.1:1023416..1023850" note="PFAM: Curlin associated KEGG: ret:RHE_PE00164 hypothetical protein" transl_table="11" db_xref="InterPro:IPR009742" db_xref="GeneID:4180926" organism="Fusobacterium nucleatum subsp. vincentii ATCC 49256" strain="ATCC 49256" sub_species="vincentii" db_xref="taxon:209882" product="Nitrogen regulatory IIA protein" ec_number="2.7.1.69" calculated_mol_wt="35415" region_name="PTS_IIA_fru" note="PTS_IIA, PTS system, fructose/mannitol specific IIA subunit. The bacterial phosphoenolpyruvate: sugar phosphotransferase system (PTS) is a multi-protein system involved in the regulation of a variety of metabolic and transcriptional processes; cd00211" db_xref="CDD:29266" site_type="active" db_xref="CDD:29266" site_type="phosphorylation" db_xref="CDD:29266" region_name="CBS_pair_23" note="The CBS domain, named after human CBS, is a small domain originally identified in cystathionine beta-synthase and is subsequently found in a wide range of different proteins. CBS domains usually occur in tandem repeats; cd04636" db_xref="CDD:73134" region_name="CBS_pair_16" note="The CBS domain, named after human CBS, is a small domain originally identified in cystathionine beta-synthase and is subsequently found in a wide range of different proteins. CBS domains usually occur in tandem repeats; cd04629" db_xref="CDD:73127" locus_tag="FNV2288" coded_by="complement(NZ_AABF02000001.1:15503..16438)" transl_table="11" organism="Magnetospirillum magnetotacticum MS-1" strain="MS-1" db_xref="taxon:272627" product="COG1472: Beta-glucosidase-related glycosidases" calculated_mol_wt="13080" region_name="BglX" note="Beta-glucosidase-related glycosidases [Carbohydrate transport and metabolism]; COG1472" db_xref="CDD:31661" locus_tag="Magn03008764" coded_by="complement(NZ_AAAP01003810.1:2348..2722)" db_xref="CDD:pfam00933" db_xref="COG:COG1472" organism="Homo sapiens" db_xref="taxon:9606" chromosome="7" map="7q31.1" product="caveolin 2 isoform c" note="caveolae protein, 20-kD" calculated_mol_wt="12649">54
/region_name="Caveolin"
/note="Caveolin. All three known Caveolin forms have the
FEDVIAEP caveolin 'signature motif' within their
hydrophilic N-terminal domain; pfam01146"
/db_xref="CDD:72768"
Site 19
/site_type="phosphorylation"
/experiment="experimental evidence, no additional details
recorded"
/citation=[8]
/db_xref="HPRD:01819"
Site 23
/site_type="phosphorylation"
/experiment="experimental evidence, no additional details
recorded"
/citation=[7]
Site 27
/site_type="phosphorylation"
/experiment="experimental evidence, no additional details
recorded"
/citation=[6]
Site 36
/site_type="phosphorylation"
/experiment="experimental evidence, no additional details
recorded"
/citation=[7]
CDS 1..112
/gene="CAV2"
/coded_by="NM_198212.1:393..731"
/GO_component="caveolar membrane [PMID 8552590]; integral
to plasma membrane [PMID 8552590]; lipid raft [PMID
11294831]; perinuclear region [PMID 8552590]; plasma
membrane [PMID 15788404]; transport vesicle [PMID
11256614]"
/GO_function="protein binding [PMID 10212252]; protein
homodimerization activity [PMID 8552590]"
/note="isoform c is encoded by transcript variant 2"
/db_xref="CCDS:CCDS5765.1"
/db_xref="GeneID:858"
/db_xref="HGNC:1528"
/db_xref="HPRD:03029"
/db_xref="MIM:601048"
ORIGIN
1 mgletekadv qlfmdddsys hhsgleyadp ekfadsdqdr dphrlnshlk dfnafckdlp
61 ngsafsadnm eecdrcyhcs ivyerrtmll fcqpatepgl ntwtpgleig il
//
Disclaimer | Write to the Help Desk
NCBI | NLM | NIH
Aug 28 2007 16:53:42
----------------------------------------------------------------------------------------------------------------
11/
NCBI Protein banner
My NCBI
[Sign In] [Register]
PubMed Nucleotide Protein Genome Structure PMC Taxonomy OMIM Books
Search for
Limits Preview/Index History Clipboard Details
Display Show
Range: from to Features: SNP CDD MGC HPRD STS tRNA microRNA Exon
1: NP_845389. Reports hypothetical prot...[gi:30263012] BLink, Links
* Comment
* Features
* Sequence
LOCUS NP_845389 135 aa linear BCT 04-DEC-2007
DEFINITION hypothetical protein BA3059 [Bacillus anthracis str. Ames].
ACCESSION NP_845389
VERSION NP_845389.1 GI:30263012
DBSOURCE REFSEQ: accession NC_003997.3
KEYWORDS .
SOURCE Bacillus anthracis str. Ames
ORGANISM Bacillus anthracis str. Ames
Bacteria; Firmicutes; Bacillales; Bacillaceae; Bacillus; Bacillus
cereus group.
REFERENCE 1 (residues 1 to 135)
AUTHORS Read,T., Peterson,S., Tourasse,N., Baillie,L., Paulsen,I.,
Nelson,K., Tettelin,H., Fouts,D., Eisen,J., Gill,S., Holtzapple,E.,
Okstad,O., Helgason,E., Rilstone,J., Wu,M., Kolonay,J., Beanan,M.,
Dodson,R., Brinkac,L., Gwinn,M., DeBoy,R., Madupu,R., Daugherty,S.,
Durkin,A., Haft,D., Nelson,W., Peterson,J., Pop,M., Khouri,H.,
Radune,D., Benton,J., Mahamoud,Y., Jiang,L., Hance,I., Weidman,J.,
Berry,K., Plaut,R., Wolf,A., Watkins,K., Nierman,W., Hazen,A.,
Cline,R., Redmond,C., Thwaite,J., White,O., Salzberg,S.,
Thomason,B., Friedlander,A., Koehler,T., Hanna,P., Kolsto,A.-B. and
Fraser,C.
TITLE The genome sequence of Bacillus anthracis Ames and comparison to
closely related bacteria
JOURNAL Nature 423 (6935), 81-86 (2003)
PUBMED 12721629
REFERENCE 2 (residues 1 to 135)
CONSRTM NCBI Genome Project
TITLE Direct Submission
JOURNAL Submitted (10-SEP-2004) National Center for Biotechnology
Information, NIH, Bethesda, MD 20894, USA
REFERENCE 3 (residues 1 to 135)
AUTHORS Read,T., Peterson,S., Tourasse,N., Baillie,L., Paulsen,I.,
Nelson,K., Tettelin,H., Fouts,D., Eisen,J., Gill,S., Holtzapple,E.,
Okstad,O., Helgason,E., Rilstone,J., Wu,M., Kolonay,J., Beanan,M.,
Dodson,R., Brinkac,L., Gwinn,M., DeBoy,R., Madupu,R., Daugherty,S.,
Durkin,A., Haft,D., Nelson,W., Peterson,J., Pop,M., Khouri,H.,
Radune,D., Benton,J., Mahamoud,Y., Jiang,L., Hance,I., Weidman,J.,
Berry,K., Plaut,R., Wolf,A., Watkins,K., Nierman,W., Hazen,A.,
Cline,R., Redmond,C., Thwaite,J., White,O., Salzberg,S.,
Thomason,B., Friedlander,A., Koehler,T., Hanna,P., Kolsto,A.-B. and
Fraser,C.
TITLE Direct Submission
JOURNAL Submitted (26-MAR-2003) The Institute for Genomic Research, 9712
Medical Center Dr, Rockville, MD 20850, USA
COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final
NCBI review. The reference sequence was derived from AAP26875.
Method: conceptual translation.
FEATURES Location/Qualifiers
source 1..135
/organism="Bacillus anthracis str. Ames"
/strain="Ames"
/db_xref="taxon:198094"
Protein 1..135
/product="hypothetical protein"
/calculated_mol_wt=14913
CDS 1..135
/locus_tag="BA3059"
/coded_by="complement(NC_003997.3:2818810..2819217)"
/transl_table=11
/db_xref="GeneID:1086490"
ORIGIN
1 minrkcerck eitgtlhggk kikeeflced clqkgiasge ielsqaeekq tshlsikilk
61 imsviyligs ilmafstgpf ihnlgfdeis isgselglis ivmlgsifqs vlvfcgiwvf
121 illvetviki yekmk
//
Disclaimer | Write to the Help Desk
NCBI | NLM | NIH
Aug 28 2007 16:53:42
--------------------------------------------------------------------------------------------------------------
12/
NCBI Protein banner
My NCBI
[Sign In] [Register]
PubMed Nucleotide Protein Genome Structure PMC Taxonomy OMIM Books
Search for
Limits Preview/Index History Clipboard Details
Display Show
Range: from to Features: SNP CDD MGC HPRD STS tRNA microRNA Exon
1: XP_681747. Reports hypothetical prot...[gi:67902982] BLink, Links
* Comment
* Features
* Sequence
LOCUS XP_681747 433 aa linear PLN 29-SEP-2005
DEFINITION hypothetical protein AN8478.2 [Aspergillus nidulans FGSC A4].
ACCESSION XP_681747 XP_412615
VERSION XP_681747.1 GI:67902982
DBSOURCE REFSEQ: accession XM_676655.1
KEYWORDS .
SOURCE Aspergillus nidulans FGSC A4
ORGANISM Aspergillus nidulans FGSC A4
Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
Eurotiomycetes; Eurotiomycetidae; Eurotiales; Trichocomaceae;
Emericella.
REFERENCE 1 (residues 1 to 433)
AUTHORS Birren,B., Nusbaum,C., Abouelleil,A., Allen,N., Anderson,S.,
Arachchi,H.M., Barna,N., Bastien,V., Bloom,T., Boguslavkiy,L.,
Boukhgalter,B., Butler,J., Calvo,S.E., Camarata,J., Chang,J.,
Choepel,Y., Collymore,A., Cook,A., Cooke,P., Corum,B.,
DeArellano,K., Diaz,J.S., Dodge,S., Dooley,K., Dorris,L.,
Elkins,T., Engels,R., Erickson,J., Faro,S., Ferreira,P.,
FitzGerald,M., Gage,D., Galagan,J., Gardyna,S., Gnerre,S.,
Graham,L., Grand-Pierre,N., Hafez,N., Hagopian,D., Hagos,B.,
Hall,J., Horton,L., Hulme,W., Iliev,I., Jaffe,D., Johnson,R.,
Jones,C., Kamal,M., Kamat,A., Karatas,A., Kells,C., Landers,T.,
Levine,R., Lindblad-Toh,K., Liu,G., Lui,A., Ma,L.-J., Mabbitt,R.,
MacLean,C., Macdonald,P., Major,J., Manning,J., Matthews,C.,
Mauceli,E., McCarthy,M., Meldrim,J., Meneus,L., Mihova,T.,
Mlenga,V., Murphy,T., Naylor,J., Nguyen,C., Nicol,R., Nielsen,C.B.,
Norbu,C., O'Connor,T., O'Donnell,P., O'Neil,D., Oliver,J.,
Peterson,K., Phunkhang,P., Pierre,N., Purcell,S., Rachupka,A.,
Ramasamy,U., Raymond,C., Retta,R., Rise,C., Rogov,P., Roman,J.,
Schauer,S., Schupback,R., Seaman,S., Severy,P., Smirnov,S.,
Smith,C., Spencer,B., Stange-Thomann,N., Stojanovic,N., Stubbs,M.,
Talamas,J., Tesfaye,S., Theodore,J., Topham,K., Travers,M.,
Vassiliev,H., Venkataraman,V.S., Viel,R., Vo,A., Wang,S.,
Wilson,B., Wu,X., Wyman,D., Young,G., Zainoun,J., Zembek,L.,
Zimmer,A., Zody,M. and Lander,E.
TITLE Genome Sequence of Aspergillus nidulans
JOURNAL Unpublished
REFERENCE 2 (residues 1 to 433)
AUTHORS Birren,B., Nusbaum,C., Abouelleil,A., Allen,N., Anderson,S.,
Arachchi,H.M., Barna,N., Bastien,V., Bloom,T., Boguslavkiy,L.,
Boukhgalter,B., Butler,J., Calvo,S.E., Camarata,J., Chang,J.,
Choepel,Y., Collymore,A., Cook,A., Cooke,P., Corum,B.,
DeArellano,K., Diaz,J.S., Dodge,S., Dooley,K., Dorris,L.,
Elkins,T., Engels,R., Erickson,J., Faro,S., Ferreira,P.,
FitzGerald,M., Gage,D., Galagan,J., Gardyna,S., Gnerre,S.,
Graham,L., Grand-Pierre,N., Hafez,N., Hagopian,D., Hagos,B.,
Hall,J., Horton,L., Hulme,W., Iliev,I., Jaffe,D., Johnson,R.,
Jones,C., Kamal,M., Kamat,A., Karatas,A., Kells,C., Landers,T.,
Levine,R., Lindblad-Toh,K., Liu,G., Lui,A., Ma,L.-J., Mabbitt,R.,
MacLean,C., Macdonald,P., Major,J., Manning,J., Matthews,C.,
Mauceli,E., McCarthy,M., Meldrim,J., Meneus,L., Mihova,T.,
Mlenga,V., Murphy,T., Naylor,J., Nguyen,C., Nicol,R., Nielsen,C.B.,
Norbu,C., O'Connor,T., O'Donnell,P., O'Neil,D., Oliver,J.,
Peterson,K., Phunkhang,P., Pierre,N., Purcell,S., Rachupka,A.,
Ramasamy,U., Raymond,C., Retta,R., Rise,C., Rogov,P., Roman,J.,
Schauer,S., Schupback,R., Seaman,S., Severy,P., Smirnov,S.,
Smith,C., Spencer,B., Stange-Thomann,N., Stojanovic,N., Stubbs,M.,
Talamas,J., Tesfaye,S., Theodore,J., Topham,K., Travers,M.,
Vassiliev,H., Venkataraman,V.S., Viel,R., Vo,A., Wang,S.,
Wilson,B., Wu,X., Wyman,D., Young,G., Zainoun,J., Zembek,L.,
Zimmer,A., Zody,M. and Lander,E.
TITLE Direct Submission
JOURNAL Submitted (04-APR-2003) Broad Institute, 320 Charles Street,
Cambridge, MA 02142, USA
COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final
NCBI review. The reference sequence was derived from EAA67100.
Method: conceptual translation.
FEATURES Location/Qualifiers
source 1..433
/organism="Aspergillus nidulans FGSC A4"
/strain="FGSC A4"
/db_xref="taxon:227321"
Protein 1..433
/product="hypothetical protein"
/calculated_mol_wt=46888
CDS 1..433
/locus_tag="AN8478.2"
/coded_by="XM_676655.1:1..1302"
/db_xref="GeneID:2868631"
ORIGIN
1 msihvvsktn nhqhatidlp psdssplkqs svrirpslls ltsnnltyal lgnflrwwda
61 ypvpqsapap ynnttewgiv pawglatvle stlpgiplgt vlfgfwptgs havdlelkps
121 eldghwkevs ehrahlmply nryrvfdtqg kdvtefawda avgtvfaagy lmseyiftsd
181 pavrppihpc givtdqgvqd wtaadadlsr avlvslgast ktarsmaynl fqrpsgtgpl
241 gllqftsspg pigeaaraln dangkskfav gnlgypdvgl aakwladiep lprkviiadf
301 gsrdgilesv vedikkmesl qgvdiviiav gnqqkvytlg eiqarqasfa slnkvqmnts
361 dvyeaaiklr gaadyfrevd qawqswlenr eaaapdlnlv wgegiagqeg ieagwdrlca
421 ssvapgealv yri
//
Disclaimer | Write to the Help Desk
NCBI | NLM | NIH
Aug 28 2007 16:53:42
----------------------------------------------------------------------------------------------------------------
13/
NCBI Protein banner
My NCBI
[Sign In] [Register]
PubMed Nucleotide Protein Genome Structure PMC Taxonomy OMIM Books
Search for
Limits Preview/Index History Clipboard Details
Display Show
Range: from to Features: CDD SNP MGC HPRD STS tRNA microRNA Exon
1: ZP_00155584. Reports COG1823: Predicte...[gi:46128994] BLink, Conserved Domains, Links
* Comment
* Features
* Sequence
LOCUS ZP_00155584 440 aa linear BCT 01-OCT-2004
DEFINITION COG1823: Predicted Na+/dicarboxylate symporter [Haemophilus
influenzae R2846].
ACCESSION ZP_00155584
VERSION ZP_00155584.2 GI:46128994
DBSOURCE REFSEQ: accession NZ_AADO01000001.1
KEYWORDS .
SOURCE Haemophilus influenzae R2846
ORGANISM Haemophilus influenzae R2846
Bacteria; Proteobacteria; Gammaproteobacteria; Pasteurellales;
Pasteurellaceae; Haemophilus.
REFERENCE 1 (residues 1 to 440)
AUTHORS Erwin,A.L., Smith,A., Kibukawa,M., Zhou,Y., Kaul,R.K. and
Olson,M.V.
TITLE Haemophilus influenzae R2846
JOURNAL Unpublished
REFERENCE 2 (residues 1 to 440)
AUTHORS NCBI Microbial Genomes Annotation Project.
TITLE Direct Submission
JOURNAL Submitted (01-OCT-2004) National Center for Biotechnology
Information, NIH, Bethesda, MD 20894, USA
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from an annotated genomic sequence
(NZ_AADO01000001) using gene prediction method: GeneMark.
Also see:
Documentation of NCBI's Annotation Process
On Apr 2, 2004 this sequence version replaced gi:42630040.
Protein-coding genes were predicted using GeneMark and GeneMarkHMM
programs (kindly provided by M. Borodovsky). Functional annotation
is based on CDD (Conserved Domain Database) and COG (Clusters of
Orthologous Groups) assignments, it has not yet been subject to
manual review. DNA sequence and predicted proteins are available
for BLAST at http://www.ncbi.nlm.nih.gov/sutils/genom_table.cgi.
project_ID=9670.
Method: conceptual translation.
FEATURES Location/Qualifiers
source 1..440
/organism="Haemophilus influenzae R2846"
/strain="R2846"
/db_xref="taxon:262727"
Protein 1..440
/product="COG1823: Predicted Na+/dicarboxylate symporter"
/calculated_mol_wt=46226
Region 20..440
/region_name="COG1823"
/note="Predicted Na+/dicarboxylate symporter [General
function prediction only]; COG1823"
/db_xref="CDD:32008"
CDS 1..440
/locus_tag="Hflu103000009"
/coded_by="complement(NZ_AADO01000001.1:11152..12474)"
/db_xref="COG:COG1823"
ORIGIN
1 mllvnlaifi afllllaqly rkteklgqtv figlllgllf gavlqsafek plldktldwi
61 nvvgngyvrl lqmivmplvf vsilsaiari nqtkslgkvs vgvlstllit tavsaaigia
121 mvhlfdvsaa glivgdrela aqgkvldkag qvsnltvpam lvsfipknpf adltganpts
181 iisvvifsal lgvaalslgk edqalgeria qgvetlnklv mrlvrfvihl tpygvfalmi
241 kmaatskwad ivnlgnfiva syaaialmfv vhgillffvk vnpvdyykkv lptlsfafts
301 rssaatipln ietqtaklgn snvianfaat fgatigqngc ggiypamlav mvapmvgidp
361 fsfsyiptli fvvaissfgi agvgggatfa aivvlstlgl pleligllis ieplidmgrt
421 alnvngamva gtitdrllnk
//
Disclaimer | Write to the Help Desk
NCBI | NLM | NIH
Aug 28 2007 16:53:42
----------------------------------------------------------------------------------------------------------------
14/
NCBI Protein banner
My NCBI
[Sign In] [Register]
PubMed Nucleotide Protein Genome Structure PMC Taxonomy OMIM Books
Search for
Limits Preview/Index History Clipboard Details
Display Show
Range: from to Features: CDD SNP MGC HPRD STS tRNA microRNA Exon
1: XP_389228. Reports hypothetical prot...[gi:46133825] BLink, Conserved Domains, Links
* Comment
* Features
* Sequence
LOCUS XP_389228 557 aa linear PLN 25-APR-2006
DEFINITION hypothetical protein FG09052.1 [Gibberella zeae PH-1].
ACCESSION XP_389228
VERSION XP_389228.1 GI:46133825
DBSOURCE REFSEQ: accession XM_389228.1
KEYWORDS .
SOURCE Gibberella zeae PH-1 (Fusarium graminearum)
ORGANISM Gibberella zeae PH-1
Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
Sordariomycetes; Hypocreomycetidae; Hypocreales; Nectriaceae;
Gibberella.
COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final
NCBI review. The reference sequence was derived from EAA78102.
Method: conceptual translation.
FEATURES Location/Qualifiers
source 1..557
/organism="Gibberella zeae PH-1"
/strain="PH-1; NRRL 31084"
/db_xref="taxon:229533"
/chromosome="4"
/anamorph="Fusarium graminearum"
Protein 1..557
/product="hypothetical protein"
/calculated_mol_wt=61007
Region 40..510
/region_name="Sugar_tr"
/note="Sugar (and other) transporter; pfam00083"
/db_xref="CDD:84502"
CDS 1..557
/locus_tag="FG09052.1"
/coded_by="XM_389228.1:1..1674"
/db_xref="GeneID:2791117"
ORIGIN
1 mggapttvgt ydaalqrrqa lmgasgaral vknwkvfria afaciggily gynqgmfsgi
61 lvmksferhm gdyvqnktkk gwltsilelg awlgtlmsga iaelcsrkyg iliatsvfii
121 gvviqctamq aghnailagr fitgmgvgsl stivplynse cappevrgal valqqlaitf
181 gimvsfwidy gthfiggtge gqsdaawlip vclqlgpaii lfigimwmpf sprwlthhnr
241 eeearqvlan lrdlptdhel ielefleika qslfekrsla ekfphlqeqt agntiklqfv
301 aiaalfktka mfkrvivatv tmffqqwtgi naifeqlgls snttsllatg vvgivmfiat
361 ipavlwidrl grkpvlavga igmglchlii avilarnidq fdthpaagwa aicmvwlfvv
421 hfgyswgpca wiiiaeiwpl strpygvalg assnwmnnfi vgqvtpemld gitygtyilf
481 glltmigaaf iwffvpetkr lsleemdiif gsegaaqadn ermaeinrei glddliyrsg
541 avhsnedihq dvkdvke
//
Disclaimer | Write to the Help Desk
NCBI | NLM | NIH
Aug 28 2007 16:53:42
----------------------------------------------------------------------------------------------------------------
15/
NCBI Protein banner
My NCBI
[Sign In] [Register]
PubMed Nucleotide Protein Genome Structure PMC Taxonomy OMIM Books
Search for
Limits Preview/Index History Clipboard Details
Display Show
Range: from to Features: CDD SNP MGC HPRD STS tRNA microRNA Exon
1: XP_388666. Reports hypothetical prot...[gi:46128225] BLink, Conserved Domains, Links
* Comment
* Features
* Sequence
LOCUS XP_388666 1573 aa linear PLN 25-APR-2006
DEFINITION hypothetical protein FG08490.1 [Gibberella zeae PH-1].
ACCESSION XP_388666
VERSION XP_388666.1 GI:46128225
DBSOURCE REFSEQ: accession XM_388666.1
KEYWORDS .
SOURCE Gibberella zeae PH-1 (Fusarium graminearum)
ORGANISM Gibberella zeae PH-1
Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
Sordariomycetes; Hypocreomycetidae; Hypocreales; Nectriaceae;
Gibberella.
COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final
NCBI review. The reference sequence was derived from EAA71307.
Method: conceptual translation.
FEATURES Location/Qualifiers
source 1..1573
/organism="Gibberella zeae PH-1"
/strain="PH-1; NRRL 31084"
/db_xref="taxon:229533"
/chromosome="2"
/anamorph="Fusarium graminearum"
Protein 1..1573
/product="hypothetical protein"
/calculated_mol_wt=172752
Region <86..187 region_name="ANK" note="ankyrin repeats; ankyrin repeats mediate protein-protein interactions in very diverse families of proteins. The number of ANK repeats in a protein can range from 2 to over 20 (ankyrins, for example); cd00204" db_xref="CDD:29261">547
/region_name="ATS1"
/note="Alpha-tubulin suppressor and related RCC1
domain-containing proteins [Cell division and chromosome
partitioning / Cytoskeleton]; COG5184"
/db_xref="CDD:34783"
Region 884..1000
/region_name="BTB"
/note="BTB/POZ domain; pfam00651"
/db_xref="CDD:84929"
Region <1115..1434 region_name="Herpes_BLLF1" note="Herpes virus major outer envelope glycoprotein (BLLF1). This family consists of the BLLF1 viral late glycoprotein, also termed gp350/220; pfam05109" db_xref="CDD:68674" locus_tag="FG08490.1" coded_by="XM_388666.1:1..4722" db_xref="GeneID:2790235" style="color: rgb(51, 51, 255);">LOCUS XP_386736 460 aa linear PLN 25-APR-2006
DEFINITION hypothetical protein FG06560.1 [Gibberella zeae PH-1].
ACCESSION XP_386736
VERSION XP_386736.1 GI:46124365
DBSOURCE REFSEQ: accession XM_386736.1
KEYWORDS .
SOURCE Gibberella zeae PH-1 (Fusarium graminearum)
ORGANISM Gibberella zeae PH-1
Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
Sordariomycetes; Hypocreomycetidae; Hypocreales; Nectriaceae;
Gibberella.
COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final
NCBI review. The reference sequence was derived from EAA78345.
Method: conceptual translation.
FEATURES Location/Qualifiers
source 1..460
/organism="Gibberella zeae PH-1"
/strain="PH-1; NRRL 31084"
/db_xref="taxon:229533"
/chromosome="4"
/anamorph="Fusarium graminearum"
Protein 1..460
/product="hypothetical protein"
/calculated_mol_wt=50449
Region 140..456
/region_name="MetAP2"
/note="Methionine Aminopeptidase 2. E.C. 3.4.11.18. Also
known as methionyl aminopeptidase and peptidase M.
Catalyzes release of N-terminal amino acids,
preferentially methionine, from peptides and arylamides;
cd01088"
/db_xref="CDD:29973"
Site order(211,232,243,312,345,441)
/site_type="active"
/db_xref="CDD:29973"
CDS 1..460
/locus_tag="FG06560.1"
/coded_by="XM_386736.1:1..1383"
/db_xref="GeneID:2788523"
ORIGIN
1 mgaktseddy nggngqgpls skpssaggep rgahfardgd gslggeggdd dddddinatt
61 gsiivdgagk kkkkrkpkkk kktatqqssp prvplselfa nkdypvgeiq sysddfntar
121 ttaeevrykg rkqledpafl ndyrkaaevh rqvrqwtqen vkpghtlnei angiedgvra
181 llgnqgiepg dniksgmgfp tglclnheta hytpnpgqkd vvlkyedvmk vdfgvqingw
241 ivdsaftmsf dptydnllaa vkdatnsgik asgidvricd vsaeiqeame syeveinrkt
301 ypvkpvrnis ahnikhyqih ggksipfikn rdqtkmeege vfaietfgtt gtgklyddvg
361 iygyglqhda pknvhlpfat atklhkvire qfgtivfcrr yldrlgldry laglnslvsh
421 gileayepla dikgsysaqf ehtillresn kevisrgsdy
//
Disclaimer | Write to the Help Desk
NCBI | NLM | NIH
Aug 28 2007 16:53:42
----------------------------------------------------------------------------------------------------------------
17/
NCBI Protein banner
My NCBI
[Sign In] [Register]
PubMed Nucleotide Protein Genome Structure PMC Taxonomy OMIM Books
Search for
Limits Preview/Index History Clipboard Details
Display Show
Range: from to Features: SNP CDD MGC HPRD STS tRNA microRNA Exon
1: XP_660204. Reports hypothetical prot...[gi:67524285] BLink, Links
* Comment
* Features
* Sequence
LOCUS XP_660204 113 aa linear PLN 29-SEP-2005
DEFINITION hypothetical protein AN2600.2 [Aspergillus nidulans FGSC A4].
ACCESSION XP_660204 XP_406737
VERSION XP_660204.1 GI:67524285
DBSOURCE REFSEQ: accession XM_655112.1
KEYWORDS .
SOURCE Aspergillus nidulans FGSC A4
ORGANISM Aspergillus nidulans FGSC A4
Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
Eurotiomycetes; Eurotiomycetidae; Eurotiales; Trichocomaceae;
Emericella.
REFERENCE 1 (residues 1 to 113)
AUTHORS Birren,B., Nusbaum,C., Abouelleil,A., Allen,N., Anderson,S.,
Arachchi,H.M., Barna,N., Bastien,V., Bloom,T., Boguslavkiy,L.,
Boukhgalter,B., Butler,J., Calvo,S.E., Camarata,J., Chang,J.,
Choepel,Y., Collymore,A., Cook,A., Cooke,P., Corum,B.,
DeArellano,K., Diaz,J.S., Dodge,S., Dooley,K., Dorris,L.,
Elkins,T., Engels,R., Erickson,J., Faro,S., Ferreira,P.,
FitzGerald,M., Gage,D., Galagan,J., Gardyna,S., Gnerre,S.,
Graham,L., Grand-Pierre,N., Hafez,N., Hagopian,D., Hagos,B.,
Hall,J., Horton,L., Hulme,W., Iliev,I., Jaffe,D., Johnson,R.,
Jones,C., Kamal,M., Kamat,A., Karatas,A., Kells,C., Landers,T.,
Levine,R., Lindblad-Toh,K., Liu,G., Lui,A., Ma,L.-J., Mabbitt,R.,
MacLean,C., Macdonald,P., Major,J., Manning,J., Matthews,C.,
Mauceli,E., McCarthy,M., Meldrim,J., Meneus,L., Mihova,T.,
Mlenga,V., Murphy,T., Naylor,J., Nguyen,C., Nicol,R., Nielsen,C.B.,
Norbu,C., O'Connor,T., O'Donnell,P., O'Neil,D., Oliver,J.,
Peterson,K., Phunkhang,P., Pierre,N., Purcell,S., Rachupka,A.,
Ramasamy,U., Raymond,C., Retta,R., Rise,C., Rogov,P., Roman,J.,
Schauer,S., Schupback,R., Seaman,S., Severy,P., Smirnov,S.,
Smith,C., Spencer,B., Stange-Thomann,N., Stojanovic,N., Stubbs,M.,
Talamas,J., Tesfaye,S., Theodore,J., Topham,K., Travers,M.,
Vassiliev,H., Venkataraman,V.S., Viel,R., Vo,A., Wang,S.,
Wilson,B., Wu,X., Wyman,D., Young,G., Zainoun,J., Zembek,L.,
Zimmer,A., Zody,M. and Lander,E.
TITLE Genome Sequence of Aspergillus nidulans
JOURNAL Unpublished
REFERENCE 2 (residues 1 to 113)
AUTHORS Birren,B., Nusbaum,C., Abouelleil,A., Allen,N., Anderson,S.,
Arachchi,H.M., Barna,N., Bastien,V., Bloom,T., Boguslavkiy,L.,
Boukhgalter,B., Butler,J., Calvo,S.E., Camarata,J., Chang,J.,
Choepel,Y., Collymore,A., Cook,A., Cooke,P., Corum,B.,
DeArellano,K., Diaz,J.S., Dodge,S., Dooley,K., Dorris,L.,
Elkins,T., Engels,R., Erickson,J., Faro,S., Ferreira,P.,
FitzGerald,M., Gage,D., Galagan,J., Gardyna,S., Gnerre,S.,
Graham,L., Grand-Pierre,N., Hafez,N., Hagopian,D., Hagos,B.,
Hall,J., Horton,L., Hulme,W., Iliev,I., Jaffe,D., Johnson,R.,
Jones,C., Kamal,M., Kamat,A., Karatas,A., Kells,C., Landers,T.,
Levine,R., Lindblad-Toh,K., Liu,G., Lui,A., Ma,L.-J., Mabbitt,R.,
MacLean,C., Macdonald,P., Major,J., Manning,J., Matthews,C.,
Mauceli,E., McCarthy,M., Meldrim,J., Meneus,L., Mihova,T.,
Mlenga,V., Murphy,T., Naylor,J., Nguyen,C., Nicol,R., Nielsen,C.B.,
Norbu,C., O'Connor,T., O'Donnell,P., O'Neil,D., Oliver,J.,
Peterson,K., Phunkhang,P., Pierre,N., Purcell,S., Rachupka,A.,
Ramasamy,U., Raymond,C., Retta,R., Rise,C., Rogov,P., Roman,J.,
Schauer,S., Schupback,R., Seaman,S., Severy,P., Smirnov,S.,
Smith,C., Spencer,B., Stange-Thomann,N., Stojanovic,N., Stubbs,M.,
Talamas,J., Tesfaye,S., Theodore,J., Topham,K., Travers,M.,
Vassiliev,H., Venkataraman,V.S., Viel,R., Vo,A., Wang,S.,
Wilson,B., Wu,X., Wyman,D., Young,G., Zainoun,J., Zembek,L.,
Zimmer,A., Zody,M. and Lander,E.
TITLE Direct Submission
JOURNAL Submitted (04-APR-2003) Broad Institute, 320 Charles Street,
Cambridge, MA 02142, USA
COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final
NCBI review. The reference sequence was derived from EAA64705.
Method: conceptual translation.
FEATURES Location/Qualifiers
source 1..113
/organism="Aspergillus nidulans FGSC A4"
/strain="FGSC A4"
/db_xref="taxon:227321"
/chromosome="VII"
Protein 1..113
/product="hypothetical protein"
/calculated_mol_wt=12499
CDS 1..113
/locus_tag="AN2600.2"
/coded_by="XM_655112.1:1..342"
/db_xref="GeneID:2875260"
ORIGIN
1 mgdayafcna ympagkmtwl vcirrcdqai gqpsllllct nkavekenhq sasrytslvp
61 eslynpqsvp ppapyrayln ngytddlcmg ieqrpqtkqk alivrtgrit aim
//
Disclaimer | Write to the Help Desk
NCBI | NLM | NIH
Aug 28 2007 16:53:42
----------------------------------------------------------------------------------------------------------------
18/
NCBI Protein banner
My NCBI
[Sign In] [Register]
PubMed Nucleotide Protein Genome Structure PMC Taxonomy OMIM Books
Search for
Limits Preview/Index History Clipboard Details
Display Show
Range: from to Features: CDD SNP MGC HPRD STS tRNA microRNA Exon
1: ZP_00049507. Reports COG1029: Formylme...[gi:23007790] BLink, Conserved Domains, Links
* Comment
* Features
* Sequence
LOCUS ZP_00049507 340 aa linear BCT 30-SEP-2004
DEFINITION COG1029: Formylmethanofuran dehydrogenase subunit B
[Magnetospirillum magnetotacticum MS-1].
ACCESSION ZP_00049507
VERSION ZP_00049507.1 GI:23007790
DBSOURCE REFSEQ: accession NZ_AAAP01001915.1
KEYWORDS .
SOURCE Magnetospirillum magnetotacticum MS-1
ORGANISM Magnetospirillum magnetotacticum MS-1
Bacteria; Proteobacteria; Alphaproteobacteria; Rhodospirillales;
Rhodospirillaceae; Magnetospirillum.
REFERENCE 1 (residues 1 to 340)
AUTHORS NCBI Microbial Genomes Annotation Project.
TITLE Direct Submission
JOURNAL Submitted (30-SEP-2004) National Center for Biotechnology
Information, NIH, Bethesda, MD 20894, USA
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from an annotated genomic sequence
(NZ_AAAP01001915) using gene prediction method: GeneMark.
Also see:
Documentation of NCBI's Annotation Process
Protein-coding genes were predicted using GeneMark and GeneMarkHMM
programs (kindly provided by M. Borodovsky). Functional annotation
is based on CDD (Conserved Domain Database) and COG (Clusters of
Orthologous Groups) assignments, it has not yet been subject to
manual review. DNA sequence and predicted proteins are available
for BLAST at http://www.ncbi.nlm.nih.gov/sutils/genom_table.cgi.
Method: conceptual translation.
FEATURES Location/Qualifiers
source 1..340
/organism="Magnetospirillum magnetotacticum MS-1"
/strain="MS-1"
/db_xref="taxon:272627"
Protein 1..340
/product="COG1029: Formylmethanofuran dehydrogenase
subunit B"
/calculated_mol_wt=34720
Region 35..>250
/region_name="MopB_FmdB-FwdB"
/note="The MopB_FmdB-FwdB CD contains the
molybdenum/tungsten formylmethanofuran dehydrogenases,
subunit B (FmdB/FwdB), and other related proteins;
cd02761"
/db_xref="CDD:29457"
Site order(59,61..63,93..94,96,99,124..127,144,146,185..186,
217..218)
/site_type="other"
/note="putative molybdopterin cofactor binding site"
/db_xref="CDD:29457"
CDS 1..340
/locus_tag="Magn03002997"
/coded_by="complement(NZ_AAAP01001915.1:172..1194)"
/db_xref="CDD:pfam00205"
/db_xref="CDD:pfam03999"
/db_xref="CDD:pfam05743"
/db_xref="COG:COG1029"
ORIGIN
1 mtawvkggaa dvdaavdaaa dllaaarvpv laglsaevsa lraayrlaet lgasldpvsg
61 pslyaelgal saggamsttr aetigradlv lvvgnrpwdg sliaeiaavs psrgraagae
121 rallslggpq ngairhvaya peagglavsl ghlrafakgh lageeayadl arrlfaaqyg
181 vivydaeevg elgvemlqgl irdlnestrf faltladpfq gratvqlsaw ttgqaprvgf
241 grhqpehdpg astaparspr vrptppsgsp rsrprappgs aacrpspssa karrkprarp
301 prssspsacp arasaarsgt sgaasspmps rkgsrqrprn
//
Disclaimer | Write to the Help Desk
NCBI | NLM | NIH
Aug 28 2007 16:53:42
----------------------------------------------------------------------------------------------------------------
19/
NCBI Protein banner
My NCBI
[Sign In] [Register]
PubMed Nucleotide Protein Genome Structure PMC Taxonomy OMIM Books
Search for
Limits Preview/Index History Clipboard Details
Display Show
Range: from to Features: CDD SNP MGC HPRD STS tRNA microRNA Exon
1: ZP_00064171. Reports ...[gi:23024987] This whole-genome-shotgun sequence record was removed because it has been superceded by a new assembly of the genome.
* Comment
* Features
* Sequence
LOCUS ZP_00064171 302 aa linear BCT 01-OCT-2004
DEFINITION COG0667: Predicted oxidoreductases (related to aryl-alcohol
dehydrogenases) [Leuconostoc mesenteroides subsp. mesenteroides
ATCC 8293].
ACCESSION ZP_00064171
VERSION ZP_00064171.1 GI:23024987
DBSOURCE REFSEQ: accession NZ_AABH02000055.1
KEYWORDS .
SOURCE Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
ORGANISM Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Bacteria; Firmicutes; Lactobacillales; Leuconostoc.
REFERENCE 1 (residues 1 to 302)
AUTHORS NCBI Microbial Genomes Annotation Project.
TITLE Direct Submission
JOURNAL Submitted (01-OCT-2004) National Center for Biotechnology
Information, NIH, Bethesda, MD 20894, USA
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from an annotated genomic sequence
(NZ_AABH02000055) using gene prediction method: GeneMark.
Also see:
Documentation of NCBI's Annotation Process
Protein-coding genes were predicted using GeneMark and GeneMarkHMM
programs (kindly provided by M. Borodovsky). Functional annotation
is based on CDD (Conserved Domain Database) and COG (Clusters of
Orthologous Groups) assignments, it has not yet been subject to
manual review. DNA sequence and predicted proteins are available
for BLAST at http://www.ncbi.nlm.nih.gov/sutils/genom_table.cgi.
NOTE: On 3/7/2003, the sequences of this WGS project were
re-accessioned, from largest to smallest; this necessitated a
change to the assembly-version number of the project, from 01 to
02; the actual sequence content was not changed.
Method: conceptual translation.
FEATURES Location/Qualifiers
source 1..302
/organism="Leuconostoc mesenteroides subsp. mesenteroides
ATCC 8293"
/strain="ATCC 8293"
/sub_species="mesenteroides"
/db_xref="ATCC:8293"
/db_xref="taxon:203120"
Protein 1..302
/product="COG0667: Predicted oxidoreductases (related to
aryl-alcohol dehydrogenases)"
/calculated_mol_wt=33601
Region 10..301
/region_name="Tas"
/note="Predicted oxidoreductases (related to aryl-alcohol
dehydrogenases) [Energy production and conversion];
COG0667"
/db_xref="CDD:31011"
CDS 1..302
/locus_tag="Lmes02001876"
/coded_by="NZ_AABH02000055.1:6649..7557"
/db_xref="COG:COG0667"
ORIGIN
1 mshnqkessk alklgigtnk vgghnlfegl qdedgfdivr ealdskvqmi dtaymyglgr
61 seeiigevlk hyprssfeia tkaaqdpdnd lkinntptfl kkavddalar lqtdyidify
121 ihfpdentpk deavaalndl kksgkiravg vsnfsleqik eankngqvdy vedayslvhr
181 eaenklwpyl qenhigfvpy fplasglltg kysladadkf dqftkeqfet iisalklvek
241 isenhnasis qtilawyian psisavipga rnasqvtnnv atlnidltet eyqqidtafe
301 nf
//
Disclaimer | Write to the Help Desk
NCBI | NLM | NIH
Aug 28 2007 16:53:42
----------------------------------------------------------------------------------------------------------------
20/
NCBI Protein banner
My NCBI
[Sign In] [Register]
PubMed Nucleotide Protein Genome Structure PMC Taxonomy OMIM Books
Search for
Limits Preview/Index History Clipboard Details
Display Show
Range: from to Features: CDD SNP MGC HPRD STS tRNA microRNA Exon
1: NP_250175. Reports probable transcri...[gi:15596681] BLink, Conserved Domains, Links
* Comment
* Features
* Sequence
LOCUS NP_250175 268 aa linear BCT 02-DEC-2007
DEFINITION probable transcriptional regulator [Pseudomonas aeruginosa PAO1].
ACCESSION NP_250175
VERSION NP_250175.1 GI:15596681
DBSOURCE REFSEQ: accession NC_002516.2
KEYWORDS .
SOURCE Pseudomonas aeruginosa PAO1
ORGANISM Pseudomonas aeruginosa PAO1
Bacteria; Proteobacteria; Gammaproteobacteria; Pseudomonadales;
Pseudomonadaceae; Pseudomonas.
REFERENCE 1 (residues 1 to 268)
AUTHORS Winsor,G.L., Lo,R., Sui,S.J., Ung,K.S., Huang,S., Cheng,D.,
Ching,W.K., Hancock,R.E. and Brinkman,F.S.
TITLE Pseudomonas aeruginosa Genome Database and PseudoCAP: facilitating
community-based, continually updated, genome annotation
JOURNAL Nucleic Acids Res. 33 (DATABASE ISSUE), D338-D343 (2005)
PUBMED 15608211
REFERENCE 2 (residues 1 to 268)
AUTHORS Stover,C.K., Pham,X.-Q.T., Erwin,A.L., Mizoguchi,S.D., Warrener,P.,
Hickey,M.J., Brinkman,F.S.L., Hufnagle,W.O., Kowalik,D.J.,
Lagrou,M., Garber,R.L., Goltry,L., Tolentino,E.,
Westbrook-Wadman,S., Yuan,Y., Brody,L.L., Coulter,S.N.,
Folger,K.R., Kas,A., Larbig,K., Lim,R.M., Smith,K.A., Spencer,D.H.,
Wong,G.K.-S., Wu,Z., Paulsen,I.T., Reizer,J., Saier,M.H.,
Hancock,R.E.W., Lory,S. and Olson,M.V.
TITLE Complete genome sequence of Pseudomonas aeruginosa PA01, an
opportunistic pathogen
JOURNAL Nature 406 (6799), 959-964 (2000)
PUBMED 10984043
REFERENCE 3 (residues 1 to 268)
CONSRTM NCBI Genome Project
TITLE Direct Submission
JOURNAL Submitted (13-SEP-2001) National Center for Biotechnology
Information, NIH, Bethesda, MD 20894, USA
REFERENCE 4 (residues 1 to 268)
AUTHORS Stover,C.K., Pham,X.-Q.T., Erwin,A.L., Mizoguchi,S.D., Warrener,P.,
Hickey,M.J., Brinkman,F.S.L., Hufnagle,W.O., Kowalik,D.J.,
Lagrou,M., Garber,R.L., Goltry,L., Tolentino,E.,
Westbrock-Wadman,S., Yuan,Y., Brody,L.L., Coulter,S.N.,
Folger,K.R., Kas,A., Larbig,K., Lim,R.M., Smith,K.A., Spencer,D.H.,
Wong,G.K.-S., Wu,Z., Paulsen,I.T., Reizer,J., Saier,M.H.,
Hancock,R.E.W., Lory,S. and Olson,M.V.
TITLE Direct Submission
JOURNAL Submitted (16-MAY-2000) Department of Medicine and Genetics,
University of Washington Genome Center, University Of Washington,
Box 352145, Seattle, WA 98195, USA
COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final
NCBI review. The reference sequence was derived from AAG04873.
Method: conceptual translation.
FEATURES Location/Qualifiers
source 1..268
/organism="Pseudomonas aeruginosa PAO1"
/strain="PAO1"
/db_xref="taxon:208964"
Protein 1..268
/product="probable transcriptional regulator"
/calculated_mol_wt=30278
Region <142..252 region_name="MalT" note="ATP-dependent transcriptional regulator [Transcription]; COG2909" db_xref="CDD:32733" region_name="HTH_LUXR" note="helix_turn_helix, Lux Regulon; lux regulon (activates the bioluminescence operon; smart00421" db_xref="CDD:47728" locus_tag="PA1484" coded_by="complement(NC_002516.2:1609738..1610544)" transl_table="11" db_xref="GeneID:881626">
DEVELOPING STORY
